Species Specific Primer Designing – An Easy Method for Identification of Bacillus thuringiensis.

Order of Publishing in Issue: 
11
Volume :5
Issue :4
October, 2011
Page No: 
1469-1472
Authors: 
Mangesh More, Chetan Narkhede, Shivaji Deshmukh, Aniket Gade and Mahendra Rai
Address: 
Department of Biotechnology, Sant Gadge Baba Amravati University Amravati-444 602, Maharashtra India.

Abstract
Identification and differentiation of Bacillus thuringiensis from B. cereus which causes food poisoning and B. anthracis, a causal agent of anthrax is not easy. The three Bacilli species share a great number of phenotypic and biochemical characteristics therefore, their authentic identification remains a problem. In the present study, we have applied newly developed methodology of the species-specific primer designing and use of polymerase chain reaction for identification and differentiation among commercial B. thuringiensis from B. cereus and B. anthracis. We have designed species-specific primers successfully by comparing different cry sequence using the primer designing tool Ampliconb 09. The forward primer was found to be ccactacttacagccgtag whereas, the reverse primer was agttgatatgcgtctaggtggt there was no self complementarities and Hairpin shown by the primers. By using this set of primers it is easy to differentiate B. thuringiensis from B. anthracis and B. cereus. However, results need to be confirmed by wet lab techniques.

Keywords: 
Bacillus thuringiensis; Ampliconb09 and cry sequences
AttachmentSize
Paper-11.pdf87.42 KB

 
To download full text articles and issues in PDF at no cost.All you have to do is fill out a brief registration form. It's easy and it's free. At any time, you may request removal of your contact information from our database.
Click here to Register | Click here if you have already registered

2018 ABAP Awards

Invitation for Nominations to 2019 ABAP Awards
The Association of Biotechnology and Pharmacy invites nominations for the following awards from the eligible talented people with proven track record and achievements on or before August 31, 2019 in the prescribed format.

DOWNLOAD CIRCULAR | APPLICATION FORM

AWARDS

User login